ID: 1199264195

View in Genome Browser
Species Human (GRCh38)
Location X:145811122-145811144
Sequence CAAAATGCTGATGATTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199264195_1199264196 12 Left 1199264195 X:145811122-145811144 CCAAAATAATCATCAGCATTTTG No data
Right 1199264196 X:145811157-145811179 TCTTAAACATTACATTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199264195 Original CRISPR CAAAATGCTGATGATTATTT TGG (reversed) Intergenic
No off target data available for this crispr