ID: 1199264872

View in Genome Browser
Species Human (GRCh38)
Location X:145818178-145818200
Sequence CAGTGGGGATTGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 366}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199264872_1199264891 19 Left 1199264872 X:145818178-145818200 CCCTCTACCCTCAATCCCCACTG 0: 1
1: 0
2: 3
3: 33
4: 366
Right 1199264891 X:145818220-145818242 CCGTCCGCGCGGGCGTGGTCGGG 0: 1
1: 0
2: 1
3: 3
4: 59
1199264872_1199264880 -6 Left 1199264872 X:145818178-145818200 CCCTCTACCCTCAATCCCCACTG 0: 1
1: 0
2: 3
3: 33
4: 366
Right 1199264880 X:145818195-145818217 CCACTGGAGATTCCTCACCCCGG 0: 1
1: 0
2: 1
3: 12
4: 135
1199264872_1199264889 18 Left 1199264872 X:145818178-145818200 CCCTCTACCCTCAATCCCCACTG 0: 1
1: 0
2: 3
3: 33
4: 366
Right 1199264889 X:145818219-145818241 ACCGTCCGCGCGGGCGTGGTCGG 0: 1
1: 0
2: 1
3: 1
4: 36
1199264872_1199264883 8 Left 1199264872 X:145818178-145818200 CCCTCTACCCTCAATCCCCACTG 0: 1
1: 0
2: 3
3: 33
4: 366
Right 1199264883 X:145818209-145818231 TCACCCCGGGACCGTCCGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1199264872_1199264881 -5 Left 1199264872 X:145818178-145818200 CCCTCTACCCTCAATCCCCACTG 0: 1
1: 0
2: 3
3: 33
4: 366
Right 1199264881 X:145818196-145818218 CACTGGAGATTCCTCACCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 196
1199264872_1199264888 14 Left 1199264872 X:145818178-145818200 CCCTCTACCCTCAATCCCCACTG 0: 1
1: 0
2: 3
3: 33
4: 366
Right 1199264888 X:145818215-145818237 CGGGACCGTCCGCGCGGGCGTGG 0: 1
1: 0
2: 2
3: 17
4: 125
1199264872_1199264884 9 Left 1199264872 X:145818178-145818200 CCCTCTACCCTCAATCCCCACTG 0: 1
1: 0
2: 3
3: 33
4: 366
Right 1199264884 X:145818210-145818232 CACCCCGGGACCGTCCGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199264872 Original CRISPR CAGTGGGGATTGAGGGTAGA GGG (reversed) Exonic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
902113398 1:14101511-14101533 GAGTAGGGATTGAAGGGAGAGGG + Intergenic
902146125 1:14400684-14400706 CAATGGTTATTGAGGGTTGATGG - Intergenic
902860819 1:19244171-19244193 CACGGGGTAATGAGGGTAGAAGG + Intronic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903074239 1:20750094-20750116 TAGGGTGGATGGAGGGTAGATGG - Intronic
903646470 1:24899070-24899092 CAGTGGGGATTGGGAGTAAGCGG - Intergenic
903861104 1:26364952-26364974 AAGTGGGTATCCAGGGTAGAAGG + Exonic
904368704 1:30034935-30034957 CAGTGGGGTGTGGGGTTAGATGG - Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904692232 1:32302047-32302069 TAGTGTGAATTGAAGGTAGAGGG + Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907355436 1:53869078-53869100 AAGTGGGCATGGAAGGTAGAGGG + Intronic
907494687 1:54836083-54836105 CAGAGGGGTTTGAGGGGAGAAGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907823982 1:57997687-57997709 AAGTGGGGTCTGAGGGGAGAAGG + Intronic
907856256 1:58306651-58306673 CAATGGGGAATGAAGGTAAAAGG + Intronic
907934883 1:59033128-59033150 CAGTGGGGATTGCGGTGAAATGG + Intergenic
909046987 1:70722378-70722400 CTGTTGGGAGTGAGGGTGGAGGG - Intergenic
909629481 1:77756585-77756607 CAGTGAGGATTGACTGTAGATGG + Intronic
910106655 1:83638489-83638511 AATGGGAGATTGAGGGTAGAGGG - Intergenic
911573412 1:99545035-99545057 TAGTGAGGAGTGGGGGTAGAGGG - Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912496334 1:110094492-110094514 CAGAGGGGGTTGGGGGTAAATGG - Intergenic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916299335 1:163256425-163256447 CAGTGGTGTTTGGAGGTAGAGGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917215329 1:172672247-172672269 CAGTAGGGAGTGATGGAAGAAGG + Intergenic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918223530 1:182457525-182457547 CAAATGGGATTGAGGGAAGAGGG + Intronic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920498803 1:206473394-206473416 CAGTGGGCATTGAGGGTGGTGGG + Intronic
920788875 1:209069797-209069819 CAGGGGGCATTGAGGGTCTATGG - Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921279611 1:213552883-213552905 CAGTAGTGCTTGAAGGTAGAAGG - Intergenic
921465940 1:215487849-215487871 TGGTGGGGATTTAGAGTAGAAGG - Intergenic
921936463 1:220801174-220801196 CAGAGGGGAGTGAGAGGAGAAGG - Intronic
923323155 1:232856563-232856585 CAGTGGGGAGGGAGTGTCGATGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924566235 1:245200794-245200816 CAGGGCTGATTGAGGGTATAGGG + Intronic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1063282198 10:4642435-4642457 TAGTGGGGTTGGGGGGTAGATGG + Intergenic
1063972474 10:11390853-11390875 CAATGGAGATAGAGAGTAGAAGG + Intergenic
1066069480 10:31792220-31792242 CACTGGGGCCTGAGGGTAGAGGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1070288721 10:75101076-75101098 CAGTGAGGAGTGTGGGGAGAAGG + Intronic
1070414576 10:76177746-76177768 CAATGAGGATTGAGGGGAGAGGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071452503 10:85810616-85810638 CAGTTGGGAGTGAGGGTGCATGG - Intronic
1073787306 10:106903958-106903980 AAGTGAGGATTGAGGGAAGAAGG - Intronic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1076731998 10:132443918-132443940 GAGTGGGGGTTGAGAGGAGAGGG - Intergenic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078464463 11:11539985-11540007 CAATGGGAAATGAGGGGAGACGG + Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080997273 11:37619250-37619272 CAGTGGGGATTGTGGGGTGGGGG - Intergenic
1081729341 11:45358156-45358178 CATTTGGGATGGAGGGCAGAGGG + Intergenic
1082204380 11:49414668-49414690 CAGTGTGGCTTGTGGGTAGGAGG - Intergenic
1082954744 11:58857855-58857877 GAGTAGGGAATGAGGGTAGCAGG - Intronic
1083352505 11:62040922-62040944 CAATGGGCATTGAGGCTAGGTGG + Intergenic
1083799599 11:65038832-65038854 GAGTAGGGACTGAGGGTGGAGGG + Intronic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085327439 11:75617857-75617879 CAGTTGAGATTGAGGAGAGAAGG + Intronic
1086539615 11:87892610-87892632 CAGTGGGGAGTGACAGTAGTAGG - Intergenic
1088827327 11:113506925-113506947 CCTTGGGGAATGAGGGCAGAAGG + Intergenic
1091777807 12:3195981-3196003 CAGTCGTGAGTGGGGGTAGAAGG + Intronic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1095238873 12:39833406-39833428 CAGTGGGGAATGAATGTTGAAGG - Intronic
1096053560 12:48632032-48632054 CAGTGGGGTTTGGTGGGAGAGGG + Intergenic
1096334678 12:50744475-50744497 TGGTTGGGATTGAGGGGAGAAGG + Intronic
1096394876 12:51258208-51258230 CAGTTGAGAGTGAGGGTAGGAGG + Intronic
1096589374 12:52647333-52647355 CAGTGAGTATTGAGGGCAGCTGG - Intronic
1097270024 12:57768329-57768351 CAGTGGGGAATGAGGGAGTAAGG - Intronic
1099293741 12:80804400-80804422 CCATGGAGATAGAGGGTAGAAGG - Intronic
1100213797 12:92426801-92426823 CATTGGGATTTGATGGTAGAAGG + Intronic
1101072384 12:101089417-101089439 AAGTGGAGATTGAAAGTAGATGG + Intronic
1101937424 12:109069653-109069675 CAGTGGGGGATGAGGATAGCAGG + Intronic
1102099399 12:110266842-110266864 CAGTGGGGAGGGAAGGTAAAGGG - Intergenic
1102662471 12:114541667-114541689 CAGTGGGGATTTAGGAATGAGGG + Intergenic
1102665269 12:114566634-114566656 CAGTGGGGATTTAGGAATGAGGG - Intergenic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1104745909 12:131210425-131210447 CAGAGGGGAATGTGGGCAGAGGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105213956 13:18273711-18273733 CAGTGAGTTTTGAGGGTGGAGGG - Intergenic
1106977233 13:35234561-35234583 CAGTGGGAAATGAGACTAGATGG + Intronic
1108213138 13:48158403-48158425 TAGAGAGAATTGAGGGTAGAAGG - Intergenic
1109184846 13:59255702-59255724 AAGTGGGGAGTGAGGAAAGAAGG + Intergenic
1112196273 13:97229696-97229718 CAGTGGGGAATAAAGTTAGATGG + Intronic
1112823966 13:103370306-103370328 CAGTGGGAGATGAGGGTAGCTGG + Intergenic
1113865256 13:113517796-113517818 AAGTGGGGACTGTGGGTGGAGGG + Intronic
1114260215 14:21031193-21031215 CAATGGGGATTTAGGGAAGTAGG - Intronic
1115731180 14:36271503-36271525 CACTGGGGCTTGAGGGGAGGGGG + Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1118448278 14:65871598-65871620 TAATGGGGCTTGAGAGTAGAAGG + Intergenic
1119729146 14:76940119-76940141 CAGAGGGGATTGAGGGTGCCAGG - Intergenic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1120862479 14:89267196-89267218 CAGTGGGTTCTCAGGGTAGACGG + Intronic
1121406233 14:93720855-93720877 CAGTGGGGATAGGAGGGAGAAGG + Exonic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122659157 14:103282828-103282850 CACTGGGGATGGAGGATGGAGGG + Intergenic
1123007703 14:105332392-105332414 CAGTGGGGAGTGAGAGGAGCAGG + Intronic
1123058815 14:105585277-105585299 GAGGGAGGATTGAGGATAGATGG - Intergenic
1123126919 14:105953535-105953557 GAGAGTGGATTGAGAGTAGATGG + Intergenic
1124815634 15:32989252-32989274 CACTGGGGATGGAAGGTAGGTGG + Intronic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1127297779 15:57624924-57624946 CAGTTAGGACTGAGGGTGGAAGG - Intronic
1128331167 15:66756668-66756690 CAGTGGAGATTGGGGCCAGAAGG + Intronic
1128550630 15:68595998-68596020 CAGTGAGGTTTGAGTGTGGAGGG + Intronic
1129239443 15:74242816-74242838 CAGTGGGGACTCAGAGAAGACGG - Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130760001 15:86809343-86809365 CAGGGGCTTTTGAGGGTAGAAGG - Intronic
1130933725 15:88451002-88451024 CAGTGGGGACTGGTGGTAGGGGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1139224600 16:65222153-65222175 CAGTGGGATTTGACTGTAGAAGG - Intergenic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1140942214 16:79732835-79732857 CAGTGGGCAATGTTGGTAGAGGG - Intergenic
1141369280 16:83472304-83472326 CAGTGGGGATTTATGTTAGACGG + Intronic
1141498823 16:84429626-84429648 CAGTGGGGATGGAGAATCGATGG + Intronic
1141515251 16:84539763-84539785 CAGTGGAGAATGAGGGGTGAGGG + Intronic
1141675267 16:85514272-85514294 CAGTTGAGATTCAGGGGAGAAGG + Intergenic
1141959686 16:87396617-87396639 CAGTGTGGATTCAGTGTATAGGG - Intronic
1142169600 16:88614839-88614861 CAGTGGGGTCTCAGGGGAGAAGG - Intronic
1142700941 17:1660366-1660388 CAGGTGGAATTGAGGGGAGAGGG - Intronic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1146139937 17:30357073-30357095 CACTGGAGAATGAGGGTACAAGG + Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1156305114 18:35872167-35872189 CAGTCAGGATTGAGGCAAGAAGG - Intergenic
1156914443 18:42448491-42448513 GAGTGGTGATTTAGGGTAGCAGG - Intergenic
1157605528 18:48923684-48923706 TAGTGGGGGTTGGGGGTTGAGGG - Intronic
1159874864 18:73799565-73799587 GGGTAGGGATTGAGGGTAAAGGG - Intergenic
1160612758 18:80101399-80101421 CAGTGTGGTTTGGGGGTAGGAGG - Intergenic
1163389523 19:17021906-17021928 CCCTGGGGATTTAGGGCAGAAGG + Intronic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1166301197 19:41913051-41913073 CAGGAGGGATTGCGGGGAGAGGG - Intronic
1166565650 19:43763864-43763886 CAGTGGAGAATGAGGGCAGGCGG + Intergenic
1166787358 19:45376394-45376416 AAGTGGGGTTTGCGGGTAGTGGG + Intergenic
1167139029 19:47636850-47636872 CAGTGGGAAGTGAGGTTACAGGG - Intronic
1167161282 19:47768880-47768902 CAGGAGGGACTGAGGGTAGTAGG + Intergenic
1168148511 19:54432585-54432607 CATTGGGCATTGAGAGTAGATGG - Intronic
1168456251 19:56511018-56511040 TGGTGGGGATTGAGTGAAGAAGG + Intronic
1168472685 19:56652243-56652265 CAGCGGGGAGTGAGGGAAGCTGG + Intronic
1168721574 19:58557563-58557585 CAGTGAGGACTGAGGGTTGGTGG - Intronic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
926463120 2:13158287-13158309 CTGTGGCGATTGAGGGGAAACGG + Intergenic
926764755 2:16314566-16314588 CCCTAGGGATTGAGTGTAGATGG + Intergenic
926892614 2:17650853-17650875 GAGTGGGCATTGAAGATAGAAGG - Intronic
928035046 2:27815138-27815160 CAATGGGCATTGAGGGCAGTGGG + Intronic
928292999 2:30056348-30056370 CAGTGGGGATTGGTGGTGGGTGG - Intergenic
929223185 2:39486408-39486430 CAAAGGGGATTGGGGGAAGAAGG - Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929918546 2:46155794-46155816 CAATGGGGATAGTGGGGAGAAGG - Intronic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
934300367 2:91773038-91773060 CAGTGAGTTTTGAGGGTGGAGGG + Intergenic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
936793611 2:116181768-116181790 TAGTGAGGGTTGCGGGTAGAAGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
942462449 2:176177913-176177935 CGAGGGGGATTGAGGGAAGATGG - Intergenic
944119672 2:196227551-196227573 CTGGGGGCATTGATGGTAGAAGG - Intronic
944679653 2:202065406-202065428 GATTGGGGATTGATGGAAGAGGG - Intergenic
944912776 2:204326710-204326732 GAGTGTGTATTGAGGGTAGAGGG + Intergenic
946033425 2:216723298-216723320 GAGTGGGGTTAGAGGGCAGAAGG - Intergenic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
946485654 2:220098607-220098629 CAGTGGAGATTGGAGGTAGTGGG - Intergenic
948272831 2:236687439-236687461 CAGTGGGGATTAAGAGGAGGTGG + Intergenic
1168737101 20:149875-149897 CAGTGAGGATAGAGGATAGGAGG + Intergenic
1168922527 20:1552406-1552428 CAGTGGAGATGTAGGGTTGAAGG - Intronic
1169141341 20:3228897-3228919 CAGCGGGGAGTGGGGGTAGGCGG + Exonic
1170100037 20:12688837-12688859 TAGTGGGGATTGAGGAAAGGTGG - Intergenic
1170370618 20:15644142-15644164 CAATGGGGATGCAGTGTAGAGGG - Intronic
1170683506 20:18547724-18547746 CAGTGGGGAGTGGGGGTGGAGGG - Intronic
1170793548 20:19527195-19527217 AAGTGGGAATTTAGAGTAGAGGG - Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171030943 20:21675794-21675816 CATTGAGCATTGAGGGTTGAAGG - Intergenic
1171394357 20:24821966-24821988 GAGTGGGGATTGGAGGAAGATGG - Intergenic
1172518863 20:35554553-35554575 CAGGAGGGATTGAGGCTAGAGGG + Intronic
1172838884 20:37890162-37890184 AAGTGGGGTTTGAGGGGAAAGGG + Intergenic
1173038481 20:39436023-39436045 AAGTGGGGGGTGAGGGGAGAGGG - Intergenic
1173667483 20:44773311-44773333 CAGTGGAGATAGAGGGTCGGGGG - Intronic
1174308986 20:49635762-49635784 GGGTGGGGATTGAGGGTGGAGGG - Exonic
1174318522 20:49721832-49721854 CAGAGGGGATTGGTGGCAGAAGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1176667387 21:9700037-9700059 CAGTGAGGAATAAGGGTGGAGGG - Intergenic
1181133101 22:20745871-20745893 CAGTGAGGAGTGATGGTGGAAGG - Intronic
1181439702 22:22929393-22929415 CAGTGGGCATTGCGAGTGGATGG - Intergenic
1181528482 22:23502871-23502893 GATTGGGGATGGAGGGTGGAGGG - Intergenic
1182788402 22:32927599-32927621 TAGTAGAGATTGAGGGTAAATGG - Intronic
1182917395 22:34047714-34047736 CAGTGGTGATTGAGATGAGACGG - Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183661224 22:39222587-39222609 CACTGGGGATTTAGGGGAGAAGG + Intergenic
1184119513 22:42440998-42441020 CAGTGGGGAAACAGAGTAGAGGG - Intergenic
1184829512 22:46975256-46975278 CACTCGGGGTGGAGGGTAGACGG + Intronic
1185256978 22:49839472-49839494 GTGTGGGGAATGAGGGTAGGCGG + Intergenic
952089690 3:29869594-29869616 CAGTTTGTATTGAGGGTAAATGG - Intronic
952105946 3:30069554-30069576 AAGTGGGGATTGAGTGCACAAGG - Intergenic
953262601 3:41354238-41354260 CACTGTGGACTGAGGGGAGAAGG - Intronic
954185115 3:48911045-48911067 CACTGGGGAAGGAGCGTAGATGG + Intergenic
954468801 3:50674672-50674694 GAGTGGGGAGTCCGGGTAGAGGG + Intergenic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
954763800 3:52896900-52896922 CACTGGGGATTGAGGGATGTGGG + Intronic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
959502152 3:107119024-107119046 CGGTGGGGGTTGGGGGTAGGGGG - Intergenic
960054165 3:113264821-113264843 GAGGGGGGATAGAGGGTAGGAGG + Intronic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961329001 3:126128018-126128040 CAGTGGGGCATGAGGGTGGAGGG + Intronic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964184192 3:153923171-153923193 CAGTGGGTTTTCAGGGTTGATGG + Intergenic
964311184 3:155394903-155394925 CTGTGGGGAGTGGGGGTCGAGGG - Intronic
964706536 3:159624627-159624649 CCGTGGAGATTGGGGGTGGAAGG + Intronic
965398256 3:168186918-168186940 AAGTGGGGAGTCAGGGGAGAAGG + Intergenic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967500034 3:190186761-190186783 CAGTGGGGATCCAGGGTTGGAGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968651405 4:1761589-1761611 CAGAGGGAAGTGACGGTAGATGG - Intergenic
968829967 4:2928301-2928323 CAGTGGGGCTTGGGGGTCTATGG - Exonic
968958432 4:3730599-3730621 CGGTGGGGATTGGGGGCACAGGG + Intergenic
969144691 4:5112195-5112217 CAGTAAGGATAGAGGGGAGATGG + Intronic
969965631 4:10992403-10992425 CAGTGGGGAATGAAGGAGGAAGG + Intergenic
970423393 4:15925754-15925776 CAGTGGGGAGTGTGGGGCGATGG - Intergenic
970454109 4:16204835-16204857 CAGTGGTGAGTGAGGCCAGAAGG - Intronic
971068124 4:23058590-23058612 CAGGGTGGAGTGAGGGTTGAGGG + Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
972840780 4:42927900-42927922 GAGTGGGGATTGAGCAGAGAAGG + Intronic
973130781 4:46646059-46646081 CAGTGTTGATTTAGGGTGGAAGG - Intergenic
973730282 4:53816354-53816376 CACAGGGGATTGAGGCAAGAGGG - Intronic
974349350 4:60724440-60724462 CAGTGGGGAGAGAGAGTGGATGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
976466245 4:85372039-85372061 GAGTGGGGAGGGAGGGTTGAAGG + Intergenic
977573848 4:98657500-98657522 CAGTGGGGGTGCGGGGTAGAGGG - Intronic
977845896 4:101766470-101766492 CAGAGAGGATTGAGGGGAGATGG - Intronic
978778228 4:112523374-112523396 AAGAAGGGATTGAGGGTTGAAGG + Intergenic
978802277 4:112766650-112766672 CTGCTGGGCTTGAGGGTAGAGGG - Intergenic
979402853 4:120271790-120271812 CAATGTGGGGTGAGGGTAGAAGG - Intergenic
981801912 4:148667649-148667671 CCGAGGGGATGGTGGGTAGAAGG - Intergenic
982644044 4:158000056-158000078 TATTGGGGATTGATGATAGAAGG + Intergenic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
983154709 4:164332461-164332483 CAGTGGGGATTAAAACTAGATGG + Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984287389 4:177749569-177749591 CAGAGGTGGGTGAGGGTAGAGGG - Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985407420 4:189651557-189651579 CAGTGAGGAATAAGGGTGGAGGG + Intergenic
985521367 5:375390-375412 CAGTGGGGAGTGAGGGTGGTGGG + Intronic
985637069 5:1041216-1041238 CAGTGGTGAGTGAGGGCTGAGGG + Intergenic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986280625 5:6319206-6319228 CAGTGTGCATTGAGTGTTGAGGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
988658367 5:33237342-33237364 CAGTGCAGGTTGAGAGTAGAAGG + Intergenic
988695975 5:33623249-33623271 CAGTAGGGCCTGAGGGGAGAGGG - Intronic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
994021054 5:95026477-95026499 CAATGGAGATAGAGAGTAGAAGG - Intronic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
995766220 5:115622666-115622688 CAATGGGGAATGAGGAAAGATGG - Intronic
997470262 5:134113533-134113555 CAGTTGGGATAGAGGGTATTTGG - Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998797902 5:145838300-145838322 CAGAGTGGATTGAGGATACAGGG - Intergenic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999056824 5:148587037-148587059 CAGTGGGGGTTCAGGGGAGCTGG - Intronic
1000244394 5:159437226-159437248 AAGTGGGCATTAAGAGTAGATGG + Intergenic
1003203551 6:3986710-3986732 CAGTGGAGATAAAAGGTAGATGG - Intergenic
1003558808 6:7164268-7164290 CAGTGGGGATTGATGATAGTAGG - Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004693442 6:18012188-18012210 CAGTGGGGAGTGGGGGGAGCTGG - Intergenic
1005824552 6:29624925-29624947 CAGTGGGGAGCCAGGGCAGAGGG + Intronic
1005963231 6:30708161-30708183 CAATGGGGATTCAAGGCAGAGGG - Exonic
1006258383 6:32848960-32848982 CACTGGGGAGTGAAGGTGGAGGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006898293 6:37484431-37484453 CAGTGGGAAGTGAGGGGTGAAGG - Intronic
1007199588 6:40095414-40095436 CAGTGGGGAGTGGGAGTTGATGG + Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007762476 6:44141116-44141138 CAGCAGGGCTTGAGGGTAGGGGG - Intronic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012555386 6:100505339-100505361 CAGAGGGTAGTGAGGGGAGAAGG + Intergenic
1014337404 6:120154547-120154569 CATTTGGGATTGATGGTAGATGG - Intergenic
1015747643 6:136527081-136527103 CGGTAGGGATTGAGGGTGGGGGG - Intronic
1015863391 6:137703397-137703419 CAGTGGGGAATGTGTGCAGAGGG - Intergenic
1017366326 6:153645068-153645090 CAGTGGGAAATAATGGTAGATGG + Intergenic
1018880758 6:167877510-167877532 AAGGGGTGATTGGGGGTAGAAGG + Intronic
1019475112 7:1240675-1240697 GAGTGGGGAGTGAGGAGAGAAGG + Intergenic
1020359738 7:7315406-7315428 CAGTGCTGATTTAGTGTAGAGGG - Intergenic
1020893343 7:13907629-13907651 CATTGGGGATTGAGTGTCTAGGG + Intronic
1020989685 7:15181399-15181421 CAGTGAAGAATGAGAGTAGAAGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1022236882 7:28470252-28470274 CCATGGAGATAGAGGGTAGAAGG - Intronic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1022877845 7:34553152-34553174 CAGTATGGATCGAGGGTTGAGGG - Intergenic
1023590865 7:41779215-41779237 CAGTAGGGATTGCGGGAAGAAGG + Intergenic
1026433614 7:70373150-70373172 CAGGGGGGAGTGGGGGAAGAAGG + Intronic
1028641247 7:93044051-93044073 GATTGGGGGTTGGGGGTAGACGG + Intergenic
1028642252 7:93055254-93055276 CAGGAGGGATTTAGGTTAGATGG + Intergenic
1032159498 7:129499984-129500006 AGGTGGGGATTGGGGGTAGTGGG - Intergenic
1032350973 7:131163361-131163383 CACTGAGGATCGAAGGTAGAAGG + Intronic
1032614515 7:133452515-133452537 CAGAGGCTATTGGGGGTAGATGG - Intronic
1032713436 7:134483213-134483235 CACTGGGGAGTGGGGGTGGAAGG + Intergenic
1033227451 7:139572963-139572985 CAGTGGGTATCCAGTGTAGACGG + Exonic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035038739 7:155912119-155912141 CAATGGGGATTAAAGGTAGAAGG - Intergenic
1035697061 8:1606388-1606410 AAGTGGGGAGTGACGGTACAGGG - Intronic
1035961937 8:4147347-4147369 CACTGAGGACTGAGGGAAGAAGG - Intronic
1035981905 8:4381649-4381671 CACTGGGGAATGAGGGTTGGGGG - Intronic
1036627609 8:10484419-10484441 CTGTGGGGACTGAGTATAGAAGG + Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1038131406 8:24735991-24736013 CAGTGGGGCAGGTGGGTAGAAGG + Intergenic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039436808 8:37565055-37565077 CGGTGGGAAATGAGGGTGGATGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1041785911 8:61633963-61633985 CAGTGGAGTTTGAGGTTAGTCGG - Intronic
1042699648 8:71598243-71598265 CAGGTGGGGTTGAGGGTAGAGGG + Intergenic
1043322398 8:79005843-79005865 CACTGAGGATTGAGGTTAGTGGG + Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045845283 8:106627847-106627869 AAGTGGAGATTGAGGGCACAGGG + Intronic
1046002426 8:108437131-108437153 CAGTGGGGATAGAGGTATGATGG - Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049414013 8:142487274-142487296 CAGCGGGGAATGGGGGCAGACGG - Intronic
1050277073 9:4011031-4011053 CAGCGGGGAGTGGAGGTAGATGG + Intronic
1050738389 9:8790686-8790708 TAGTGTGGATTGAGGTTAAAAGG + Intronic
1052154980 9:25175380-25175402 CTGTGTGGATTGATGGTAGTAGG - Intergenic
1052480981 9:29025801-29025823 CAGGGGTGGTTAAGGGTAGAGGG - Intergenic
1052795019 9:32915606-32915628 TAGATGGGATTGAGGGGAGATGG + Intergenic
1053663786 9:40302967-40302989 CAGTGGGGGTTGTGGGTGGTAGG + Intronic
1053914332 9:42934225-42934247 CAGTGGGGGTTGTGGGTGGTAGG + Intergenic
1054520827 9:66073318-66073340 CAGTGGGGGTTGTGGGTGGTAGG - Intergenic
1056505057 9:87250596-87250618 CAGAGGGGATTCTGGGAAGATGG - Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1057531114 9:95847543-95847565 GGGTGGGGAGTGGGGGTAGAGGG - Intergenic
1058219830 9:102284792-102284814 CTTTGGGGATTGAGGGGAAAAGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1060077111 9:120601764-120601786 CCTAGGGGATAGAGGGTAGAGGG + Exonic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1061033206 9:128099261-128099283 CAGTGGGCACTGGGGGTAGCAGG - Intronic
1061664113 9:132150338-132150360 CAGGTGGGAAGGAGGGTAGAAGG + Intergenic
1203658428 Un_KI270753v1:20661-20683 CAGTGAGGAATAAGGGTGGAGGG + Intergenic
1186301336 X:8202935-8202957 TAGTGGGGATGGAGAGTATATGG - Intergenic
1186875873 X:13817209-13817231 CAGTGGGAGTTGGGGGTAGGGGG + Exonic
1187035025 X:15529317-15529339 AAGAGGGGGGTGAGGGTAGAAGG - Intronic
1187039669 X:15580299-15580321 CAGAGGGGAATGAGGGAAGCAGG - Intronic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1188286415 X:28330701-28330723 GAATGGGGATTGACTGTAGATGG - Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1190970278 X:55341851-55341873 CAGTGGGGCTTTGGGGCAGAGGG - Intergenic
1191895730 X:65990758-65990780 CAGTGGGGGCTGAGGAGAGAGGG + Intergenic
1192623765 X:72706781-72706803 TAGTGGGGCTAGAGGGTAAAGGG - Intronic
1192914286 X:75636737-75636759 AAGAGGGAATTGAGGGTAGAAGG + Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195238379 X:102925400-102925422 CCATGGAGATAGAGGGTAGAAGG - Intergenic
1196154551 X:112413660-112413682 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1199102184 X:143815496-143815518 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199492233 X:148413066-148413088 CTGAGGGGATTGAGGGGAAATGG + Intergenic
1199760799 X:150902596-150902618 CAGTGGGGAGTGAGGTGGGAAGG - Intergenic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic