ID: 1199271290

View in Genome Browser
Species Human (GRCh38)
Location X:145885573-145885595
Sequence TACTGGCATTTATTGGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199271290_1199271295 4 Left 1199271290 X:145885573-145885595 CCTCTATCCAATAAATGCCAGTA No data
Right 1199271295 X:145885600-145885622 CCCACCCCCTGCTCCTGTTACGG No data
1199271290_1199271302 29 Left 1199271290 X:145885573-145885595 CCTCTATCCAATAAATGCCAGTA No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199271290 Original CRISPR TACTGGCATTTATTGGATAG AGG (reversed) Intergenic
No off target data available for this crispr