ID: 1199271294

View in Genome Browser
Species Human (GRCh38)
Location X:145885600-145885622
Sequence CCGTAACAGGAGCAGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199271294_1199271308 20 Left 1199271294 X:145885600-145885622 CCCACCCCCTGCTCCTGTTACGG No data
Right 1199271308 X:145885643-145885665 TATGGCCAAATGTTGTGGGTGGG No data
1199271294_1199271306 16 Left 1199271294 X:145885600-145885622 CCCACCCCCTGCTCCTGTTACGG No data
Right 1199271306 X:145885639-145885661 CAGATATGGCCAAATGTTGTGGG No data
1199271294_1199271305 15 Left 1199271294 X:145885600-145885622 CCCACCCCCTGCTCCTGTTACGG No data
Right 1199271305 X:145885638-145885660 CCAGATATGGCCAAATGTTGTGG No data
1199271294_1199271302 2 Left 1199271294 X:145885600-145885622 CCCACCCCCTGCTCCTGTTACGG No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271294_1199271310 22 Left 1199271294 X:145885600-145885622 CCCACCCCCTGCTCCTGTTACGG No data
Right 1199271310 X:145885645-145885667 TGGCCAAATGTTGTGGGTGGGGG No data
1199271294_1199271307 19 Left 1199271294 X:145885600-145885622 CCCACCCCCTGCTCCTGTTACGG No data
Right 1199271307 X:145885642-145885664 ATATGGCCAAATGTTGTGGGTGG No data
1199271294_1199271309 21 Left 1199271294 X:145885600-145885622 CCCACCCCCTGCTCCTGTTACGG No data
Right 1199271309 X:145885644-145885666 ATGGCCAAATGTTGTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199271294 Original CRISPR CCGTAACAGGAGCAGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr