ID: 1199271302

View in Genome Browser
Species Human (GRCh38)
Location X:145885625-145885647
Sequence ACCAAAAACATCTCCAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199271294_1199271302 2 Left 1199271294 X:145885600-145885622 CCCACCCCCTGCTCCTGTTACGG No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271299_1199271302 -4 Left 1199271299 X:145885606-145885628 CCCTGCTCCTGTTACGGCAACCA No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271297_1199271302 -2 Left 1199271297 X:145885604-145885626 CCCCCTGCTCCTGTTACGGCAAC No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271296_1199271302 1 Left 1199271296 X:145885601-145885623 CCACCCCCTGCTCCTGTTACGGC No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271300_1199271302 -5 Left 1199271300 X:145885607-145885629 CCTGCTCCTGTTACGGCAACCAA No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271290_1199271302 29 Left 1199271290 X:145885573-145885595 CCTCTATCCAATAAATGCCAGTA No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271298_1199271302 -3 Left 1199271298 X:145885605-145885627 CCCCTGCTCCTGTTACGGCAACC No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271292_1199271302 12 Left 1199271292 X:145885590-145885612 CCAGTAGCGCCCCACCCCCTGCT No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271291_1199271302 22 Left 1199271291 X:145885580-145885602 CCAATAAATGCCAGTAGCGCCCC No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data
1199271293_1199271302 3 Left 1199271293 X:145885599-145885621 CCCCACCCCCTGCTCCTGTTACG No data
Right 1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199271302 Original CRISPR ACCAAAAACATCTCCAGATA TGG Intergenic
No off target data available for this crispr