ID: 1199272415

View in Genome Browser
Species Human (GRCh38)
Location X:145899319-145899341
Sequence CTGCAGAAATGGAAGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199272415_1199272422 8 Left 1199272415 X:145899319-145899341 CCTGCTGCCTTCCATTTCTGCAG No data
Right 1199272422 X:145899350-145899372 CTTCCTATGGGTTCTCCGACAGG No data
1199272415_1199272419 -4 Left 1199272415 X:145899319-145899341 CCTGCTGCCTTCCATTTCTGCAG No data
Right 1199272419 X:145899338-145899360 GCAGCCCAGCTTCTTCCTATGGG No data
1199272415_1199272418 -5 Left 1199272415 X:145899319-145899341 CCTGCTGCCTTCCATTTCTGCAG No data
Right 1199272418 X:145899337-145899359 TGCAGCCCAGCTTCTTCCTATGG No data
1199272415_1199272425 29 Left 1199272415 X:145899319-145899341 CCTGCTGCCTTCCATTTCTGCAG No data
Right 1199272425 X:145899371-145899393 GGTTTCAGCACTCTTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199272415 Original CRISPR CTGCAGAAATGGAAGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr