ID: 1199276140

View in Genome Browser
Species Human (GRCh38)
Location X:145944755-145944777
Sequence CAGCCAGCATATAATGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199276140_1199276146 22 Left 1199276140 X:145944755-145944777 CCTAGGGCATTATATGCTGGCTG No data
Right 1199276146 X:145944800-145944822 TTCCCTTCGTTCTTCTCTAAGGG No data
1199276140_1199276145 21 Left 1199276140 X:145944755-145944777 CCTAGGGCATTATATGCTGGCTG No data
Right 1199276145 X:145944799-145944821 CTTCCCTTCGTTCTTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199276140 Original CRISPR CAGCCAGCATATAATGCCCT AGG (reversed) Intergenic
No off target data available for this crispr