ID: 1199278680

View in Genome Browser
Species Human (GRCh38)
Location X:145974631-145974653
Sequence ATCTTGTTCTTGTGGTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199278680_1199278686 30 Left 1199278680 X:145974631-145974653 CCATCTAACCACAAGAACAAGAT No data
Right 1199278686 X:145974684-145974706 AGGATTCCCTATTTAATAAATGG 0: 12666
1: 6533
2: 3352
3: 2822
4: 3159
1199278680_1199278682 3 Left 1199278680 X:145974631-145974653 CCATCTAACCACAAGAACAAGAT No data
Right 1199278682 X:145974657-145974679 TATCGTAGAAAAACAAGCAATGG No data
1199278680_1199278683 4 Left 1199278680 X:145974631-145974653 CCATCTAACCACAAGAACAAGAT No data
Right 1199278683 X:145974658-145974680 ATCGTAGAAAAACAAGCAATGGG No data
1199278680_1199278685 10 Left 1199278680 X:145974631-145974653 CCATCTAACCACAAGAACAAGAT No data
Right 1199278685 X:145974664-145974686 GAAAAACAAGCAATGGGGAAAGG 0: 5471
1: 5867
2: 7360
3: 4184
4: 2965
1199278680_1199278684 5 Left 1199278680 X:145974631-145974653 CCATCTAACCACAAGAACAAGAT No data
Right 1199278684 X:145974659-145974681 TCGTAGAAAAACAAGCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199278680 Original CRISPR ATCTTGTTCTTGTGGTTAGA TGG (reversed) Intergenic
No off target data available for this crispr