ID: 1199298028

View in Genome Browser
Species Human (GRCh38)
Location X:146181351-146181373
Sequence CAGTGCAAATGTAATTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199298024_1199298028 14 Left 1199298024 X:146181314-146181336 CCCAATTAGAGAAAATGAAATAA No data
Right 1199298028 X:146181351-146181373 CAGTGCAAATGTAATTGAGGAGG No data
1199298025_1199298028 13 Left 1199298025 X:146181315-146181337 CCAATTAGAGAAAATGAAATAAA No data
Right 1199298028 X:146181351-146181373 CAGTGCAAATGTAATTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199298028 Original CRISPR CAGTGCAAATGTAATTGAGG AGG Intergenic
No off target data available for this crispr