ID: 1199300328

View in Genome Browser
Species Human (GRCh38)
Location X:146205729-146205751
Sequence GAGTGCAAACAAAAGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199300324_1199300328 6 Left 1199300324 X:146205700-146205722 CCACTATATGGAGAATGGAGGGA No data
Right 1199300328 X:146205729-146205751 GAGTGCAAACAAAAGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199300328 Original CRISPR GAGTGCAAACAAAAGGATGG TGG Intergenic
No off target data available for this crispr