ID: 1199310426

View in Genome Browser
Species Human (GRCh38)
Location X:146314394-146314416
Sequence GACAGCTCTTGGCCCGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199310426_1199310430 16 Left 1199310426 X:146314394-146314416 CCAGTAACGGGCCAAGAGCTGTC No data
Right 1199310430 X:146314433-146314455 GTTATCTGCAGAAGAAGGCAAGG No data
1199310426_1199310429 11 Left 1199310426 X:146314394-146314416 CCAGTAACGGGCCAAGAGCTGTC No data
Right 1199310429 X:146314428-146314450 GAGTAGTTATCTGCAGAAGAAGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199310426 Original CRISPR GACAGCTCTTGGCCCGTTAC TGG (reversed) Intergenic
No off target data available for this crispr