ID: 1199310490

View in Genome Browser
Species Human (GRCh38)
Location X:146314853-146314875
Sequence GACTCCTAGAAATTTTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199310483_1199310490 20 Left 1199310483 X:146314810-146314832 CCTTCATCTTAGAAGGAATATCT 0: 15
1: 130
2: 181
3: 150
4: 300
Right 1199310490 X:146314853-146314875 GACTCCTAGAAATTTTACTAAGG No data
1199310486_1199310490 -10 Left 1199310486 X:146314840-146314862 CCCCACACCACTGGACTCCTAGA No data
Right 1199310490 X:146314853-146314875 GACTCCTAGAAATTTTACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199310490 Original CRISPR GACTCCTAGAAATTTTACTA AGG Intergenic
No off target data available for this crispr