ID: 1199311581

View in Genome Browser
Species Human (GRCh38)
Location X:146327215-146327237
Sequence TTGATACCATAGATATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199311581_1199311584 -4 Left 1199311581 X:146327215-146327237 CCACCCAATATCTATGGTATCAA No data
Right 1199311584 X:146327234-146327256 TCAAAATCTCTATTTTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199311581 Original CRISPR TTGATACCATAGATATTGGG TGG (reversed) Intergenic
No off target data available for this crispr