ID: 1199319133

View in Genome Browser
Species Human (GRCh38)
Location X:146417732-146417754
Sequence CCTACCCACTATGAGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199319129_1199319133 -5 Left 1199319129 X:146417714-146417736 CCTTTTAAATCCTACTCTCCTAC No data
Right 1199319133 X:146417732-146417754 CCTACCCACTATGAGTTTGGAGG No data
1199319128_1199319133 7 Left 1199319128 X:146417702-146417724 CCTGTGCTGAGACCTTTTAAATC No data
Right 1199319133 X:146417732-146417754 CCTACCCACTATGAGTTTGGAGG No data
1199319127_1199319133 11 Left 1199319127 X:146417698-146417720 CCTACCTGTGCTGAGACCTTTTA No data
Right 1199319133 X:146417732-146417754 CCTACCCACTATGAGTTTGGAGG No data
1199319126_1199319133 20 Left 1199319126 X:146417689-146417711 CCTCATTAGCCTACCTGTGCTGA No data
Right 1199319133 X:146417732-146417754 CCTACCCACTATGAGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199319133 Original CRISPR CCTACCCACTATGAGTTTGG AGG Intergenic
No off target data available for this crispr