ID: 1199323328

View in Genome Browser
Species Human (GRCh38)
Location X:146467441-146467463
Sequence TATCAAATGAGTTAGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199323324_1199323328 16 Left 1199323324 X:146467402-146467424 CCGGGGTGAATTAGCCAGGTTTG No data
Right 1199323328 X:146467441-146467463 TATCAAATGAGTTAGCAACCAGG No data
1199323326_1199323328 2 Left 1199323326 X:146467416-146467438 CCAGGTTTGAGAGGTTTGAACTG No data
Right 1199323328 X:146467441-146467463 TATCAAATGAGTTAGCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199323328 Original CRISPR TATCAAATGAGTTAGCAACC AGG Intergenic
No off target data available for this crispr