ID: 1199325091

View in Genome Browser
Species Human (GRCh38)
Location X:146489933-146489955
Sequence AGGGAGAGTACAGTGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199325081_1199325091 8 Left 1199325081 X:146489902-146489924 CCTCCCCTGGCAGCAGCTGTGCA No data
Right 1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG No data
1199325077_1199325091 29 Left 1199325077 X:146489881-146489903 CCAATACCAGCCTTTCTGTATCC No data
Right 1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG No data
1199325084_1199325091 3 Left 1199325084 X:146489907-146489929 CCTGGCAGCAGCTGTGCACTTTG No data
Right 1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG No data
1199325080_1199325091 19 Left 1199325080 X:146489891-146489913 CCTTTCTGTATCCTCCCCTGGCA No data
Right 1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG No data
1199325078_1199325091 23 Left 1199325078 X:146489887-146489909 CCAGCCTTTCTGTATCCTCCCCT No data
Right 1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG No data
1199325082_1199325091 5 Left 1199325082 X:146489905-146489927 CCCCTGGCAGCAGCTGTGCACTT No data
Right 1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG No data
1199325083_1199325091 4 Left 1199325083 X:146489906-146489928 CCCTGGCAGCAGCTGTGCACTTT No data
Right 1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199325091 Original CRISPR AGGGAGAGTACAGTGACTGA GGG Intergenic
No off target data available for this crispr