ID: 1199325115

View in Genome Browser
Species Human (GRCh38)
Location X:146490115-146490137
Sequence CACCGCACACTGAAGTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199325111_1199325115 15 Left 1199325111 X:146490077-146490099 CCTAGTGGTCAGAACTTGAGTTT 0: 12
1: 61
2: 158
3: 271
4: 508
Right 1199325115 X:146490115-146490137 CACCGCACACTGAAGTGCTCTGG No data
1199325110_1199325115 19 Left 1199325110 X:146490073-146490095 CCATCCTAGTGGTCAGAACTTGA No data
Right 1199325115 X:146490115-146490137 CACCGCACACTGAAGTGCTCTGG No data
1199325109_1199325115 20 Left 1199325109 X:146490072-146490094 CCCATCCTAGTGGTCAGAACTTG No data
Right 1199325115 X:146490115-146490137 CACCGCACACTGAAGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199325115 Original CRISPR CACCGCACACTGAAGTGCTC TGG Intergenic
No off target data available for this crispr