ID: 1199325115 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:146490115-146490137 |
| Sequence | CACCGCACACTGAAGTGCTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199325111_1199325115 | 15 | Left | 1199325111 | X:146490077-146490099 | CCTAGTGGTCAGAACTTGAGTTT | 0: 12 1: 61 2: 158 3: 271 4: 508 |
||
| Right | 1199325115 | X:146490115-146490137 | CACCGCACACTGAAGTGCTCTGG | No data | ||||
| 1199325110_1199325115 | 19 | Left | 1199325110 | X:146490073-146490095 | CCATCCTAGTGGTCAGAACTTGA | No data | ||
| Right | 1199325115 | X:146490115-146490137 | CACCGCACACTGAAGTGCTCTGG | No data | ||||
| 1199325109_1199325115 | 20 | Left | 1199325109 | X:146490072-146490094 | CCCATCCTAGTGGTCAGAACTTG | No data | ||
| Right | 1199325115 | X:146490115-146490137 | CACCGCACACTGAAGTGCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199325115 | Original CRISPR | CACCGCACACTGAAGTGCTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||