ID: 1199338083

View in Genome Browser
Species Human (GRCh38)
Location X:146642916-146642938
Sequence GTGCTGGTGTTGAGTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199338083_1199338088 18 Left 1199338083 X:146642916-146642938 CCACAGGCACTCAACACCAGCAC No data
Right 1199338088 X:146642957-146642979 GCTGTAACATGCAGAGTCACAGG No data
1199338083_1199338087 -4 Left 1199338083 X:146642916-146642938 CCACAGGCACTCAACACCAGCAC No data
Right 1199338087 X:146642935-146642957 GCACATGAAAGCAGCTGCAGGGG No data
1199338083_1199338089 19 Left 1199338083 X:146642916-146642938 CCACAGGCACTCAACACCAGCAC No data
Right 1199338089 X:146642958-146642980 CTGTAACATGCAGAGTCACAGGG No data
1199338083_1199338090 20 Left 1199338083 X:146642916-146642938 CCACAGGCACTCAACACCAGCAC No data
Right 1199338090 X:146642959-146642981 TGTAACATGCAGAGTCACAGGGG No data
1199338083_1199338085 -6 Left 1199338083 X:146642916-146642938 CCACAGGCACTCAACACCAGCAC No data
Right 1199338085 X:146642933-146642955 CAGCACATGAAAGCAGCTGCAGG No data
1199338083_1199338091 23 Left 1199338083 X:146642916-146642938 CCACAGGCACTCAACACCAGCAC No data
Right 1199338091 X:146642962-146642984 AACATGCAGAGTCACAGGGGTGG No data
1199338083_1199338086 -5 Left 1199338083 X:146642916-146642938 CCACAGGCACTCAACACCAGCAC No data
Right 1199338086 X:146642934-146642956 AGCACATGAAAGCAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199338083 Original CRISPR GTGCTGGTGTTGAGTGCCTG TGG (reversed) Intergenic
No off target data available for this crispr