ID: 1199338085

View in Genome Browser
Species Human (GRCh38)
Location X:146642933-146642955
Sequence CAGCACATGAAAGCAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199338083_1199338085 -6 Left 1199338083 X:146642916-146642938 CCACAGGCACTCAACACCAGCAC No data
Right 1199338085 X:146642933-146642955 CAGCACATGAAAGCAGCTGCAGG No data
1199338081_1199338085 11 Left 1199338081 X:146642899-146642921 CCGTGTGCTGGGAAAAGCCACAG No data
Right 1199338085 X:146642933-146642955 CAGCACATGAAAGCAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199338085 Original CRISPR CAGCACATGAAAGCAGCTGC AGG Intergenic
No off target data available for this crispr