ID: 1199340493

View in Genome Browser
Species Human (GRCh38)
Location X:146671529-146671551
Sequence TGAAGCACACAATTTCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199340493_1199340500 29 Left 1199340493 X:146671529-146671551 CCAATGGGAAATTGTGTGCTTCA No data
Right 1199340500 X:146671581-146671603 GGAGGGTCTTGTTCACAAAGGGG No data
1199340493_1199340499 28 Left 1199340493 X:146671529-146671551 CCAATGGGAAATTGTGTGCTTCA No data
Right 1199340499 X:146671580-146671602 TGGAGGGTCTTGTTCACAAAGGG No data
1199340493_1199340498 27 Left 1199340493 X:146671529-146671551 CCAATGGGAAATTGTGTGCTTCA No data
Right 1199340498 X:146671579-146671601 TTGGAGGGTCTTGTTCACAAAGG No data
1199340493_1199340497 12 Left 1199340493 X:146671529-146671551 CCAATGGGAAATTGTGTGCTTCA No data
Right 1199340497 X:146671564-146671586 TTTAAGCTCTAGAGTTTGGAGGG No data
1199340493_1199340495 8 Left 1199340493 X:146671529-146671551 CCAATGGGAAATTGTGTGCTTCA No data
Right 1199340495 X:146671560-146671582 TAACTTTAAGCTCTAGAGTTTGG No data
1199340493_1199340496 11 Left 1199340493 X:146671529-146671551 CCAATGGGAAATTGTGTGCTTCA No data
Right 1199340496 X:146671563-146671585 CTTTAAGCTCTAGAGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199340493 Original CRISPR TGAAGCACACAATTTCCCAT TGG (reversed) Intergenic
No off target data available for this crispr