ID: 1199357586

View in Genome Browser
Species Human (GRCh38)
Location X:146879774-146879796
Sequence ATGTAGGCCTTATATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199357578_1199357586 16 Left 1199357578 X:146879735-146879757 CCACACTGCTTCTTCCAGAAATC No data
Right 1199357586 X:146879774-146879796 ATGTAGGCCTTATATGATGATGG No data
1199357583_1199357586 -8 Left 1199357583 X:146879759-146879781 CCCTGTTTTGGGACCATGTAGGC No data
Right 1199357586 X:146879774-146879796 ATGTAGGCCTTATATGATGATGG No data
1199357581_1199357586 2 Left 1199357581 X:146879749-146879771 CCAGAAATCTCCCTGTTTTGGGA No data
Right 1199357586 X:146879774-146879796 ATGTAGGCCTTATATGATGATGG No data
1199357584_1199357586 -9 Left 1199357584 X:146879760-146879782 CCTGTTTTGGGACCATGTAGGCC No data
Right 1199357586 X:146879774-146879796 ATGTAGGCCTTATATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199357586 Original CRISPR ATGTAGGCCTTATATGATGA TGG Intergenic
No off target data available for this crispr