ID: 1199363441

View in Genome Browser
Species Human (GRCh38)
Location X:146949257-146949279
Sequence ATTTAAAACACAAGAAGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199363439_1199363441 -9 Left 1199363439 X:146949243-146949265 CCTCCAAATTCTGCATTTAAAAC No data
Right 1199363441 X:146949257-146949279 ATTTAAAACACAAGAAGTTATGG No data
1199363438_1199363441 -8 Left 1199363438 X:146949242-146949264 CCCTCCAAATTCTGCATTTAAAA No data
Right 1199363441 X:146949257-146949279 ATTTAAAACACAAGAAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199363441 Original CRISPR ATTTAAAACACAAGAAGTTA TGG Intergenic
No off target data available for this crispr