ID: 1199365215

View in Genome Browser
Species Human (GRCh38)
Location X:146972402-146972424
Sequence GAGACAATCCAGATATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199365215_1199365220 12 Left 1199365215 X:146972402-146972424 CCTCCAAATATCTGGATTGTCTC No data
Right 1199365220 X:146972437-146972459 TTCCTGTAGGCCCAAAGTGAAGG No data
1199365215_1199365219 -1 Left 1199365215 X:146972402-146972424 CCTCCAAATATCTGGATTGTCTC No data
Right 1199365219 X:146972424-146972446 CTGGAGGAAACTGTTCCTGTAGG No data
1199365215_1199365221 13 Left 1199365215 X:146972402-146972424 CCTCCAAATATCTGGATTGTCTC No data
Right 1199365221 X:146972438-146972460 TCCTGTAGGCCCAAAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199365215 Original CRISPR GAGACAATCCAGATATTTGG AGG (reversed) Intergenic
No off target data available for this crispr