ID: 1199371667

View in Genome Browser
Species Human (GRCh38)
Location X:147056892-147056914
Sequence GCCTCCTAGAAATTTCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199371661_1199371667 17 Left 1199371661 X:147056852-147056874 CCATCTTAAGAGAGTTGTCTCAA No data
Right 1199371667 X:147056892-147056914 GCCTCCTAGAAATTTCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199371667 Original CRISPR GCCTCCTAGAAATTTCACTT GGG Intergenic
No off target data available for this crispr