ID: 1199379684

View in Genome Browser
Species Human (GRCh38)
Location X:147155622-147155644
Sequence GCTGCTTTTTCTAGCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199379680_1199379684 20 Left 1199379680 X:147155579-147155601 CCAGAATAGGAGAAAGATGAAGG No data
Right 1199379684 X:147155622-147155644 GCTGCTTTTTCTAGCCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199379684 Original CRISPR GCTGCTTTTTCTAGCCATGC TGG Intergenic
No off target data available for this crispr