ID: 1199385672

View in Genome Browser
Species Human (GRCh38)
Location X:147220402-147220424
Sequence CCTTATAAGTAGAAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199385672_1199385676 -4 Left 1199385672 X:147220402-147220424 CCACCTTCCTTCTACTTATAAGG No data
Right 1199385676 X:147220421-147220443 AAGGAACCCTGTGATTATGTTGG No data
1199385672_1199385677 -3 Left 1199385672 X:147220402-147220424 CCACCTTCCTTCTACTTATAAGG No data
Right 1199385677 X:147220422-147220444 AGGAACCCTGTGATTATGTTGGG No data
1199385672_1199385680 16 Left 1199385672 X:147220402-147220424 CCACCTTCCTTCTACTTATAAGG No data
Right 1199385680 X:147220441-147220463 TGGGCTCACCTAGATAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199385672 Original CRISPR CCTTATAAGTAGAAGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr