ID: 1199387721

View in Genome Browser
Species Human (GRCh38)
Location X:147242181-147242203
Sequence ATGGTAGCACTGAGACTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199387721_1199387726 13 Left 1199387721 X:147242181-147242203 CCACCCAGTCTCAGTGCTACCAT No data
Right 1199387726 X:147242217-147242239 TTGTGCATTTACAGCCAAAATGG No data
1199387721_1199387727 14 Left 1199387721 X:147242181-147242203 CCACCCAGTCTCAGTGCTACCAT No data
Right 1199387727 X:147242218-147242240 TGTGCATTTACAGCCAAAATGGG No data
1199387721_1199387729 22 Left 1199387721 X:147242181-147242203 CCACCCAGTCTCAGTGCTACCAT No data
Right 1199387729 X:147242226-147242248 TACAGCCAAAATGGGGTTATAGG No data
1199387721_1199387728 15 Left 1199387721 X:147242181-147242203 CCACCCAGTCTCAGTGCTACCAT No data
Right 1199387728 X:147242219-147242241 GTGCATTTACAGCCAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199387721 Original CRISPR ATGGTAGCACTGAGACTGGG TGG (reversed) Intergenic
No off target data available for this crispr