ID: 1199390513

View in Genome Browser
Species Human (GRCh38)
Location X:147272392-147272414
Sequence ATGTGTGTGGTGTCCTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199390513_1199390515 -2 Left 1199390513 X:147272392-147272414 CCTGAGTAGGACACCACACACAT No data
Right 1199390515 X:147272413-147272435 ATACACAGCATTCCTGAAAATGG No data
1199390513_1199390516 -1 Left 1199390513 X:147272392-147272414 CCTGAGTAGGACACCACACACAT No data
Right 1199390516 X:147272414-147272436 TACACAGCATTCCTGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199390513 Original CRISPR ATGTGTGTGGTGTCCTACTC AGG (reversed) Intergenic