ID: 1199392611

View in Genome Browser
Species Human (GRCh38)
Location X:147298325-147298347
Sequence TTTTACCATGTTGTCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 547099
Summary {0: 213, 1: 10515, 2: 136979, 3: 199297, 4: 200095}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199392611_1199392615 26 Left 1199392611 X:147298325-147298347 CCAGCCTGGACAACATGGTAAAA 0: 213
1: 10515
2: 136979
3: 199297
4: 200095
Right 1199392615 X:147298374-147298396 ACACAAAAAAGCAAAAAATTAGG No data
1199392611_1199392616 30 Left 1199392611 X:147298325-147298347 CCAGCCTGGACAACATGGTAAAA 0: 213
1: 10515
2: 136979
3: 199297
4: 200095
Right 1199392616 X:147298378-147298400 AAAAAAGCAAAAAATTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199392611 Original CRISPR TTTTACCATGTTGTCCAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr