ID: 1199392612

View in Genome Browser
Species Human (GRCh38)
Location X:147298329-147298351
Sequence GGGATTTTACCATGTTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330865
Summary {0: 11, 1: 632, 2: 13286, 3: 113470, 4: 203466}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199392612_1199392616 26 Left 1199392612 X:147298329-147298351 CCTGGACAACATGGTAAAATCCC 0: 11
1: 632
2: 13286
3: 113470
4: 203466
Right 1199392616 X:147298378-147298400 AAAAAAGCAAAAAATTAGGCAGG No data
1199392612_1199392615 22 Left 1199392612 X:147298329-147298351 CCTGGACAACATGGTAAAATCCC 0: 11
1: 632
2: 13286
3: 113470
4: 203466
Right 1199392615 X:147298374-147298396 ACACAAAAAAGCAAAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199392612 Original CRISPR GGGATTTTACCATGTTGTCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr