ID: 1199392614

View in Genome Browser
Species Human (GRCh38)
Location X:147298350-147298372
Sequence TGTATGTGTGTGTATAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199392614_1199392615 1 Left 1199392614 X:147298350-147298372 CCATCTCTATACACACACATACA No data
Right 1199392615 X:147298374-147298396 ACACAAAAAAGCAAAAAATTAGG No data
1199392614_1199392616 5 Left 1199392614 X:147298350-147298372 CCATCTCTATACACACACATACA No data
Right 1199392616 X:147298378-147298400 AAAAAAGCAAAAAATTAGGCAGG No data
1199392614_1199392617 10 Left 1199392614 X:147298350-147298372 CCATCTCTATACACACACATACA No data
Right 1199392617 X:147298383-147298405 AGCAAAAAATTAGGCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199392614 Original CRISPR TGTATGTGTGTGTATAGAGA TGG (reversed) Intergenic
No off target data available for this crispr