ID: 1199392616

View in Genome Browser
Species Human (GRCh38)
Location X:147298378-147298400
Sequence AAAAAAGCAAAAAATTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199392612_1199392616 26 Left 1199392612 X:147298329-147298351 CCTGGACAACATGGTAAAATCCC 0: 11
1: 632
2: 13286
3: 113470
4: 203466
Right 1199392616 X:147298378-147298400 AAAAAAGCAAAAAATTAGGCAGG No data
1199392611_1199392616 30 Left 1199392611 X:147298325-147298347 CCAGCCTGGACAACATGGTAAAA 0: 213
1: 10515
2: 136979
3: 199297
4: 200095
Right 1199392616 X:147298378-147298400 AAAAAAGCAAAAAATTAGGCAGG No data
1199392613_1199392616 6 Left 1199392613 X:147298349-147298371 CCCATCTCTATACACACACATAC No data
Right 1199392616 X:147298378-147298400 AAAAAAGCAAAAAATTAGGCAGG No data
1199392614_1199392616 5 Left 1199392614 X:147298350-147298372 CCATCTCTATACACACACATACA No data
Right 1199392616 X:147298378-147298400 AAAAAAGCAAAAAATTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199392616 Original CRISPR AAAAAAGCAAAAAATTAGGC AGG Intergenic
No off target data available for this crispr