ID: 1199392617

View in Genome Browser
Species Human (GRCh38)
Location X:147298383-147298405
Sequence AGCAAAAAATTAGGCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199392614_1199392617 10 Left 1199392614 X:147298350-147298372 CCATCTCTATACACACACATACA No data
Right 1199392617 X:147298383-147298405 AGCAAAAAATTAGGCAGGTGTGG No data
1199392613_1199392617 11 Left 1199392613 X:147298349-147298371 CCCATCTCTATACACACACATAC No data
Right 1199392617 X:147298383-147298405 AGCAAAAAATTAGGCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199392617 Original CRISPR AGCAAAAAATTAGGCAGGTG TGG Intergenic
No off target data available for this crispr