ID: 1199393177

View in Genome Browser
Species Human (GRCh38)
Location X:147305732-147305754
Sequence AAGGACAGTGCAGTGACTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199393168_1199393177 3 Left 1199393168 X:147305706-147305728 CCCCAGCAACAGCTGTGCACTTG No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393164_1199393177 10 Left 1199393164 X:147305699-147305721 CCCCATCCCCCAGCAACAGCTGT No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393159_1199393177 19 Left 1199393159 X:147305690-147305712 CCACCCCTCCCCCATCCCCCAGC No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393163_1199393177 11 Left 1199393163 X:147305698-147305720 CCCCCATCCCCCAGCAACAGCTG No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393169_1199393177 2 Left 1199393169 X:147305707-147305729 CCCAGCAACAGCTGTGCACTTGG No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393162_1199393177 14 Left 1199393162 X:147305695-147305717 CCTCCCCCATCCCCCAGCAACAG No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393165_1199393177 9 Left 1199393165 X:147305700-147305722 CCCATCCCCCAGCAACAGCTGTG No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393161_1199393177 15 Left 1199393161 X:147305694-147305716 CCCTCCCCCATCCCCCAGCAACA No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393171_1199393177 1 Left 1199393171 X:147305708-147305730 CCAGCAACAGCTGTGCACTTGGG No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393166_1199393177 8 Left 1199393166 X:147305701-147305723 CCATCCCCCAGCAACAGCTGTGC No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393167_1199393177 4 Left 1199393167 X:147305705-147305727 CCCCCAGCAACAGCTGTGCACTT No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data
1199393160_1199393177 16 Left 1199393160 X:147305693-147305715 CCCCTCCCCCATCCCCCAGCAAC No data
Right 1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199393177 Original CRISPR AAGGACAGTGCAGTGACTTG GGG Intergenic
No off target data available for this crispr