ID: 1199393660

View in Genome Browser
Species Human (GRCh38)
Location X:147309529-147309551
Sequence CTACCTATGGGTAAGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199393653_1199393660 -9 Left 1199393653 X:147309515-147309537 CCCTGACCCAACAGCTACCTATG No data
Right 1199393660 X:147309529-147309551 CTACCTATGGGTAAGTGGTGAGG No data
1199393654_1199393660 -10 Left 1199393654 X:147309516-147309538 CCTGACCCAACAGCTACCTATGG No data
Right 1199393660 X:147309529-147309551 CTACCTATGGGTAAGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199393660 Original CRISPR CTACCTATGGGTAAGTGGTG AGG Intergenic
No off target data available for this crispr