ID: 1199395047

View in Genome Browser
Species Human (GRCh38)
Location X:147326468-147326490
Sequence TAATTGTAACTGTTTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199395044_1199395047 23 Left 1199395044 X:147326422-147326444 CCTTGGGACCTCAGCTGTTGATT No data
Right 1199395047 X:147326468-147326490 TAATTGTAACTGTTTTACCCAGG No data
1199395045_1199395047 15 Left 1199395045 X:147326430-147326452 CCTCAGCTGTTGATTCTATTTGC No data
Right 1199395047 X:147326468-147326490 TAATTGTAACTGTTTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199395047 Original CRISPR TAATTGTAACTGTTTTACCC AGG Intergenic
No off target data available for this crispr