ID: 1199395262

View in Genome Browser
Species Human (GRCh38)
Location X:147330124-147330146
Sequence CTGATTCAGTAAATCTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199395260_1199395262 3 Left 1199395260 X:147330098-147330120 CCAGAGTATTCATTGCAATGAAA No data
Right 1199395262 X:147330124-147330146 CTGATTCAGTAAATCTAGCTTGG No data
1199395259_1199395262 14 Left 1199395259 X:147330087-147330109 CCTAAAAATAACCAGAGTATTCA No data
Right 1199395262 X:147330124-147330146 CTGATTCAGTAAATCTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199395262 Original CRISPR CTGATTCAGTAAATCTAGCT TGG Intergenic
No off target data available for this crispr