ID: 1199395262 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:147330124-147330146 |
| Sequence | CTGATTCAGTAAATCTAGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199395260_1199395262 | 3 | Left | 1199395260 | X:147330098-147330120 | CCAGAGTATTCATTGCAATGAAA | No data | ||
| Right | 1199395262 | X:147330124-147330146 | CTGATTCAGTAAATCTAGCTTGG | No data | ||||
| 1199395259_1199395262 | 14 | Left | 1199395259 | X:147330087-147330109 | CCTAAAAATAACCAGAGTATTCA | No data | ||
| Right | 1199395262 | X:147330124-147330146 | CTGATTCAGTAAATCTAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199395262 | Original CRISPR | CTGATTCAGTAAATCTAGCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||