ID: 1199409763

View in Genome Browser
Species Human (GRCh38)
Location X:147507762-147507784
Sequence AAACTCGGTAGTAAATGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199409763_1199409765 30 Left 1199409763 X:147507762-147507784 CCACTGCATTTACTACCGAGTTT No data
Right 1199409765 X:147507815-147507837 CTGTATGTGTAGCTTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199409763 Original CRISPR AAACTCGGTAGTAAATGCAG TGG (reversed) Intergenic
No off target data available for this crispr