ID: 1199409764

View in Genome Browser
Species Human (GRCh38)
Location X:147507777-147507799
Sequence ATGAGCTTTTAAAACAAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199409764_1199409768 25 Left 1199409764 X:147507777-147507799 CCGAGTTTGTTTTAAAAGCTCAT No data
Right 1199409768 X:147507825-147507847 AGCTTGTTCATGGGTCATTAGGG No data
1199409764_1199409765 15 Left 1199409764 X:147507777-147507799 CCGAGTTTGTTTTAAAAGCTCAT No data
Right 1199409765 X:147507815-147507837 CTGTATGTGTAGCTTGTTCATGG No data
1199409764_1199409767 24 Left 1199409764 X:147507777-147507799 CCGAGTTTGTTTTAAAAGCTCAT No data
Right 1199409767 X:147507824-147507846 TAGCTTGTTCATGGGTCATTAGG No data
1199409764_1199409766 16 Left 1199409764 X:147507777-147507799 CCGAGTTTGTTTTAAAAGCTCAT No data
Right 1199409766 X:147507816-147507838 TGTATGTGTAGCTTGTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199409764 Original CRISPR ATGAGCTTTTAAAACAAACT CGG (reversed) Intergenic
No off target data available for this crispr