ID: 1199409765

View in Genome Browser
Species Human (GRCh38)
Location X:147507815-147507837
Sequence CTGTATGTGTAGCTTGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199409764_1199409765 15 Left 1199409764 X:147507777-147507799 CCGAGTTTGTTTTAAAAGCTCAT No data
Right 1199409765 X:147507815-147507837 CTGTATGTGTAGCTTGTTCATGG No data
1199409763_1199409765 30 Left 1199409763 X:147507762-147507784 CCACTGCATTTACTACCGAGTTT No data
Right 1199409765 X:147507815-147507837 CTGTATGTGTAGCTTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199409765 Original CRISPR CTGTATGTGTAGCTTGTTCA TGG Intergenic
No off target data available for this crispr