ID: 1199412225

View in Genome Browser
Species Human (GRCh38)
Location X:147537422-147537444
Sequence AACAGGGAAGTACCTACGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199412225_1199412232 16 Left 1199412225 X:147537422-147537444 CCCAACGTAGGTACTTCCCTGTT No data
Right 1199412232 X:147537461-147537483 TAACCACCTCTGTATGAAGGAGG No data
1199412225_1199412231 13 Left 1199412225 X:147537422-147537444 CCCAACGTAGGTACTTCCCTGTT No data
Right 1199412231 X:147537458-147537480 ACATAACCACCTCTGTATGAAGG No data
1199412225_1199412233 17 Left 1199412225 X:147537422-147537444 CCCAACGTAGGTACTTCCCTGTT No data
Right 1199412233 X:147537462-147537484 AACCACCTCTGTATGAAGGAGGG No data
1199412225_1199412236 30 Left 1199412225 X:147537422-147537444 CCCAACGTAGGTACTTCCCTGTT No data
Right 1199412236 X:147537475-147537497 TGAAGGAGGGTATTCTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199412225 Original CRISPR AACAGGGAAGTACCTACGTT GGG (reversed) Intergenic
No off target data available for this crispr