ID: 1199418223

View in Genome Browser
Species Human (GRCh38)
Location X:147611744-147611766
Sequence ATTGCTCTTCACACTAGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199418223_1199418228 29 Left 1199418223 X:147611744-147611766 CCCAATCTAGTGTGAAGAGCAAT No data
Right 1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG No data
1199418223_1199418227 26 Left 1199418223 X:147611744-147611766 CCCAATCTAGTGTGAAGAGCAAT No data
Right 1199418227 X:147611793-147611815 AATCACAGTAAGCAGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199418223 Original CRISPR ATTGCTCTTCACACTAGATT GGG (reversed) Intergenic
No off target data available for this crispr