ID: 1199418225

View in Genome Browser
Species Human (GRCh38)
Location X:147611777-147611799
Sequence TGTGATTATATTGGTCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199418225_1199418229 4 Left 1199418225 X:147611777-147611799 CCTAGATGACCAATATAATCACA No data
Right 1199418229 X:147611804-147611826 GCAGAAAGAAGGTGGTTTTAAGG No data
1199418225_1199418230 15 Left 1199418225 X:147611777-147611799 CCTAGATGACCAATATAATCACA No data
Right 1199418230 X:147611815-147611837 GTGGTTTTAAGGAACTCCTACGG No data
1199418225_1199418228 -4 Left 1199418225 X:147611777-147611799 CCTAGATGACCAATATAATCACA No data
Right 1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG No data
1199418225_1199418227 -7 Left 1199418225 X:147611777-147611799 CCTAGATGACCAATATAATCACA No data
Right 1199418227 X:147611793-147611815 AATCACAGTAAGCAGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199418225 Original CRISPR TGTGATTATATTGGTCATCT AGG (reversed) Intergenic
No off target data available for this crispr