ID: 1199418227

View in Genome Browser
Species Human (GRCh38)
Location X:147611793-147611815
Sequence AATCACAGTAAGCAGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199418222_1199418227 30 Left 1199418222 X:147611740-147611762 CCTGCCCAATCTAGTGTGAAGAG No data
Right 1199418227 X:147611793-147611815 AATCACAGTAAGCAGAAAGAAGG No data
1199418224_1199418227 25 Left 1199418224 X:147611745-147611767 CCAATCTAGTGTGAAGAGCAATA No data
Right 1199418227 X:147611793-147611815 AATCACAGTAAGCAGAAAGAAGG No data
1199418225_1199418227 -7 Left 1199418225 X:147611777-147611799 CCTAGATGACCAATATAATCACA No data
Right 1199418227 X:147611793-147611815 AATCACAGTAAGCAGAAAGAAGG No data
1199418223_1199418227 26 Left 1199418223 X:147611744-147611766 CCCAATCTAGTGTGAAGAGCAAT No data
Right 1199418227 X:147611793-147611815 AATCACAGTAAGCAGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199418227 Original CRISPR AATCACAGTAAGCAGAAAGA AGG Intergenic
No off target data available for this crispr