ID: 1199418228

View in Genome Browser
Species Human (GRCh38)
Location X:147611796-147611818
Sequence CACAGTAAGCAGAAAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199418223_1199418228 29 Left 1199418223 X:147611744-147611766 CCCAATCTAGTGTGAAGAGCAAT No data
Right 1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG No data
1199418224_1199418228 28 Left 1199418224 X:147611745-147611767 CCAATCTAGTGTGAAGAGCAATA No data
Right 1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG No data
1199418225_1199418228 -4 Left 1199418225 X:147611777-147611799 CCTAGATGACCAATATAATCACA No data
Right 1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199418228 Original CRISPR CACAGTAAGCAGAAAGAAGG TGG Intergenic
No off target data available for this crispr