ID: 1199419426

View in Genome Browser
Species Human (GRCh38)
Location X:147627018-147627040
Sequence GCTGAGAAGTAGACAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199419426_1199419428 14 Left 1199419426 X:147627018-147627040 CCATTCACTGTCTACTTCTCAGC No data
Right 1199419428 X:147627055-147627077 CTTCTTCTAAGTGGTCTTTCTGG No data
1199419426_1199419427 5 Left 1199419426 X:147627018-147627040 CCATTCACTGTCTACTTCTCAGC No data
Right 1199419427 X:147627046-147627068 TACACGTCACTTCTTCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199419426 Original CRISPR GCTGAGAAGTAGACAGTGAA TGG (reversed) Intergenic
No off target data available for this crispr