ID: 1199420389

View in Genome Browser
Species Human (GRCh38)
Location X:147637437-147637459
Sequence TCATGGGCTGGCATTGTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420389_1199420402 22 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847
1199420389_1199420400 18 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420400 X:147637478-147637500 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060
1199420389_1199420401 19 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1199420389_1199420391 -9 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420391 X:147637451-147637473 AGCCCATGAAAGCAGCCACGAGG No data
1199420389_1199420399 17 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420399 X:147637477-147637499 GCTGTACCCTGCAAAGTCACAGG 0: 57
1: 963
2: 1540
3: 1484
4: 1213
1199420389_1199420397 -5 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420397 X:147637455-147637477 CATGAAAGCAGCCACGAGGGGGG No data
1199420389_1199420392 -8 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420392 X:147637452-147637474 GCCCATGAAAGCAGCCACGAGGG No data
1199420389_1199420394 -7 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420394 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
1199420389_1199420396 -6 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420396 X:147637454-147637476 CCATGAAAGCAGCCACGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420389 Original CRISPR TCATGGGCTGGCATTGTCTG CGG (reversed) Intergenic
No off target data available for this crispr