ID: 1199420390

View in Genome Browser
Species Human (GRCh38)
Location X:147637449-147637471
Sequence TCGTGGCTGCTTTCATGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420390_1199420400 6 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420400 X:147637478-147637500 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060
1199420390_1199420399 5 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420399 X:147637477-147637499 GCTGTACCCTGCAAAGTCACAGG 0: 57
1: 963
2: 1540
3: 1484
4: 1213
1199420390_1199420402 10 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847
1199420390_1199420407 29 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420390_1199420401 7 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1199420390_1199420406 28 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420406 X:147637500-147637522 GGTGGAACTACCCAAGGCCATGG No data
1199420390_1199420405 22 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420405 X:147637494-147637516 CACAGGGGTGGAACTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420390 Original CRISPR TCGTGGCTGCTTTCATGGGC TGG (reversed) Intergenic
No off target data available for this crispr