ID: 1199420393

View in Genome Browser
Species Human (GRCh38)
Location X:147637453-147637475
Sequence CCCCTCGTGGCTGCTTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420393_1199420400 2 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420400 X:147637478-147637500 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060
1199420393_1199420405 18 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420405 X:147637494-147637516 CACAGGGGTGGAACTACCCAAGG No data
1199420393_1199420407 25 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420393_1199420402 6 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847
1199420393_1199420399 1 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420399 X:147637477-147637499 GCTGTACCCTGCAAAGTCACAGG 0: 57
1: 963
2: 1540
3: 1484
4: 1213
1199420393_1199420401 3 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1199420393_1199420406 24 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420406 X:147637500-147637522 GGTGGAACTACCCAAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420393 Original CRISPR CCCCTCGTGGCTGCTTTCAT GGG (reversed) Intergenic
No off target data available for this crispr