ID: 1199420398

View in Genome Browser
Species Human (GRCh38)
Location X:147637466-147637488
Sequence GCAGGGTACAGCCCCCCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420398_1199420405 5 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420405 X:147637494-147637516 CACAGGGGTGGAACTACCCAAGG No data
1199420398_1199420406 11 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420406 X:147637500-147637522 GGTGGAACTACCCAAGGCCATGG No data
1199420398_1199420407 12 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420398_1199420401 -10 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1199420398_1199420402 -7 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420398 Original CRISPR GCAGGGTACAGCCCCCCTCG TGG (reversed) Intergenic
No off target data available for this crispr