ID: 1199420398

View in Genome Browser
Species Human (GRCh38)
Location X:147637466-147637488
Sequence GCAGGGTACAGCCCCCCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420398_1199420401 -10 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG No data
1199420398_1199420402 -7 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG No data
1199420398_1199420405 5 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420405 X:147637494-147637516 CACAGGGGTGGAACTACCCAAGG No data
1199420398_1199420406 11 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420406 X:147637500-147637522 GGTGGAACTACCCAAGGCCATGG No data
1199420398_1199420407 12 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420398 Original CRISPR GCAGGGTACAGCCCCCCTCG TGG (reversed) Intergenic